Spiral (15 page)

"Hey, I didn't know you had a twin." Ando uttered the same joke he always did as he approached them.

"Please, Dr Ando, don't lump me together with this guy," said Nemoto, grimacing. But it couldn't have been too awful to be told he took after his colleague, two years his senior. After all, Miyashita was liked both for his personality and his learning, and had been pegged as a future candidate for full professor.

"Everybody keeps telling us we look alike, Nemoto. I'm telling you, it's getting to be a pain in the butt. Why don't you go on a diet?" Miyashita elbowed the younger man's paunch.

"Well, if I go on a diet, you have to go on one, too."

"Then we'll be right back where we started!"

Then Miyashita offered Ando the printout he was holding, as if to put an end to the stale routine.

Ando spread out the printout he'd been given. He understood its contents at a glance. It showed the results of running a snippet of DNA through a sequencer.

All life on earth consists of one or more cells containing DNA (or, in some cases, RNA). The nuclei of these cells contain molecular compounds known as nucleic acids. There are two types of nucleic acids: DNA (deoxyribonucleic acid) and RNA (ribonucleic acid). These play different roles. DNA is the compound in which genetic information is stored in the chromosomes: it takes the form of two long threads twisted about one another in a spiral, a shape known as the double helix. The sum total of a life form's genetic information is inscribed within that double structure. This genetic information is like a set of blueprints for the construction of specialized proteins; each gene is a blueprint. In other words, genes and DNA are not the same thing. A gene is a unit of information.

So what exactly is written on these blueprints? The letters that make up the inscriptions are four chemical compounds known as bases: adenine (A), guanine (G), cytosine (C), and thymine (T) or in the case of RNA, uracil (U). These four bases work in sets of three called codons, which are translated into amino acids. For example: the codon AAC makes asparagine, the codon GCA makes alanine, etc.

Proteins are conglomerations of hundreds of these amino acid molecules, of which there are twenty types. This means that the blueprint for one protein must contain an array of bases equal in number to the number of amino acid molecules times three.

The blueprint called the gene can be thought of, then, as basically a long line of letters, looking something like this: TCTCTATACCAGTTG-GAAAATTAT… Translated, this signifies a series of amino acids that runs: TCT (serine, or Ser), CTA (leusine, or Leu), TAC (tyrosine, Tyr), CAG (glutamine, Gln), TTG (leusine, Leu), GAA (glutamic acid, Glu), AAT (asparagine, Asn), TAT (tyrosine, Tyr), etc. etc.

Ando glanced again at the base codes covering the printout, the four letters A, T, G, and C lined up seemingly at random across the page. Segments of three rows had been highlighted so as to stand out from the rest.

"What's this?"

Miyashita winked at Nemoto, as if to say,
you tell him.

"This is an analysis of a segment of DNA taken from the virus found in Ryuji Takayama's blood."

"Okay… so what's this?"

"We found a rather strange sequence of bases, something we've only seen in Takayama's virus."

"And that's what's highlighted here?"

"That is correct."

Ando took a closer look at the first highlighted series of letters.

ATGGAAGAAGAATATCGTTATATTCCTC CTCCTCAACAACAA

He looked at the next highlighted portion, and compared it with the first. He realized it was exactly the same sequence. In a group of not even a thousand bases, the exact same sequence occurred twice.

Above: between #535 and #576, and again between #815 and #856, one can observe the repetition of the 42 bases ATGGAAGAA-GAATATCGTTATATTCCTCCTCCTCAACAACAA.

Base triplets (codons) are translated into amino acids according to the principles outlined in the chart above. For example, TCT is serine (Ser), AAT is asparagine (Asn), GAA is glutamic acid (Glu). "Stop" signifies the end of a gene; the beginning code is ATG.

Below are the abbreviated and full names of the twenty amino acids:

Ando shifted his gaze from the printout to Nemoto's face.

"No matter where we slice it, we always find this identical sequence."

"How many of these are there?"

"Bases, you mean?"

"Yeah."

"Forty-two."

"Forty-two. So, fourteen codons, right? That's not very many."

"We think it means something," Nemoto said, shaking his head. "But, Dr Ando, the strange thing is…"

Miyashita interrupted. "This meaningless repetition was only found in the virus collected from Ryuji Takayama's blood, and not from the other two victims." He threw up his hands in a gesture of perplexity.

In other words..
. Ando tried to find a suitable analogy. Suppose three people, one being Ryuji, had copies of Shakespeare's
King Lear.
Then suppose that Ryuji's copy, and only his copy, had meaningless strings of letters sandwiched in between the lines. There were forty-two bases, and they worked in sets of three, each set corresponding to one amino acid. If you assigned each of these sets a letter, you'd have a series of fourteen letters. And these fourteen repeating letters were found on every page of the play, inserted at random. If you knew from the beginning that the play was
King Lear,
of course, it would be possible to go back and find the meaningless parts that had been interpolated and highlight them.

"So what do you think?" Miyashita looked to be sincerely interested in Ando's opinion. A true scientist, he was always most excited when confronted with the inexplicable.

"What do I think? I'd have to know more before I could say anything."

The three of them fell silent, glancing at one another's faces. Ando felt awkward, still holding the printout.

Something was tugging at his consciousness. In order to figure out what it was, he needed time to sit down and study the meaningless string of bases. He had an unmistakable premonition that there was something here. The question was, what? And if this meaningless base sequence had indeed been interpolated, when had it happened? Was the virus that had invaded Ryuji's body just different? Or had it mutated in Ryuji's body, with the fourteen-codon string appearing here and there as a result of that mutation? Was that even possible? And if it was, what did it mean?

An oppressive silence fell over the three men. No amount of speculation at this point could tell them how to interpret these findings.

It was Miyashita who broke the silence. "By the way, did you come here for a reason?"

Ando had been so intrigued by the discovery that his original errand had slipped his mind. "Right, I almost forgot." He opened up his briefcase, took out his planner, and showed Miyashita and Nemoto a slip of paper.

"I was wondering if anyone here had a word processor of this model."

Miyashita and Nemoto looked at the model name written on the paper. It was a fairly common machine.

"Does it have to be exactly the same model?"

"As long as it's the same brand, the model probably isn't important. Basically, it's a question of compatibility for a floppy disk."

" Compatibility? "

"Yes." Ando took a floppy disk from his briefcase.

"I need to make a hard copy and a soft copy of the files on this disk."

"It's not saved in MS-DOS, I take it?"

"I don't think so."

Nemoto clapped his hands, as if he'd just remembered something. "Hey, one of the staff members in my department-Ueda, I think-has this very model."

"Do you suppose he'd let me borrow it?" Ando hesitated. He'd never met this Ueda.

"I don't imagine there'd be a problem. He's fresh out of school." Nemoto spoke with the confidence of a senior staff member who knew that a new resident would do anything he asked.

"Thanks."

"No problem at all. Why don't we go over right now? I think he's there."

This was music to Ando's ears. He couldn't wait to print out whatever was on this disk.

"Great. Let's go." Ando dropped the disk back into his jacket pocket. Then, waving to Miyashita, he followed Nemoto out of the Pathology Department.

Ando and Nemoto walked side by side down the med school's dim hallway. Ando wore his lab coat unfastened in front, its tails swept back behind him, with his hands in the pockets of his jacket clutching the disk. Neither Miyashita nor Nemoto had asked about it. Ando wasn't trying to keep it a secret. Had Miyashita asked, he'd intended to give him an honest answer. If they'd known it might hold the key to this whole mystery, no doubt both men would have been at his heels right now.

Of course, Ando hadn't seen what was on the disk yet. There was always the possibility that it held something else entirely. He simply wouldn't know until he managed to bring it up on a monitor. Still, it felt right in his hand: the disk was warm from being in his pocket. It was near body temperature. Its touch seemed to tell him that it held living words.

Nemoto opened the door to the biochemistry lab. Ando took the disk out of his pocket, switched it to his left hand, and held the door open with his right.

"Hey, Ueda." Nemoto beckoned to a skinny young man seated in a corner of the room.

"Yes?"

Ueda swiveled in his chair to face Nemoto, but didn't stand up. Nemoto approached him, smiling, and put his hand on Ueda's shoulder. "Are you using your word processor right now?"

"No, not really."

"Great. Would you mind if Dr Ando here borrowed it for a while?"

Ueda looked up at Ando and then bowed. "Hello."

"Sorry about this. I've got a disk I need to access and it's not compatible with my machine." Ando moved to Nemoto's side, holding up the disk.

"Go right ahead," said Ueda, picking up the word processor from where it sat on the floor at his feet and laying it sideways on the desktop.

"Do you mind if I check it right here just to make sure?"

"Not at all."

He opened the word processor's lid and turned it on. Soon the initial menu appeared on the screen. From among the options displayed, Ando chose DOCUMENTS, then inserted the disk. The next screen gave him two options: NEW DOCUMENT and OPEN DOCUMENT. Ando moved the cursor to the second option and hit return. With a whir, the machine started to read the disk. Finally, the names of the files stored on the disk appeared on the screen.